| |
|
|
| Year : 2012 | Volume
: 23
| Issue : 4 | Page : 454-458 |
|
| Comparative analysis of presence of Cytomegalovirus (CMV) and Epsteinbarr virus -1 (EBV-1) in cases of chronic periodontitis and aggressive periodontitis with controls |
|
|
Rupali Sharma1, Ogoti Padmalatha1, Gurumoorthy Kaarthikeyan1, ND Jayakumar1, Sheeja Varghese1, Khalefathullah Sherif2
1 Department of Periodontics, Saveetha Dental College and Hospitals, Chennai, India
2 Department of Virology, King Institute, Chennai, India
Click here for correspondence address and email
| Date of Web Publication | 20-Dec-2012 |
|
|
 |
|
 Abstract | | |
Aim : The aim of the present study was to evaluate the presence of Cytomegalovirus (CMV) and Epsteinbarr virus -1 (EBV-1)viruses in sub gingival plaque of chronic periodontitis (groupA), aggressive periodontitis patients (group B), periodontally healthy controls (group C) and to compare the clinical parameters between virus negative and positive sites in each of these groups.
Materials and Methods : Sixty subjects were included in the study and equally divided into the 3 groups (group A - 20, group B - 20, group C - 20). Sub gingival plaque samples were obtained from the 3 deepest periodontal pocket sites in case of subjects suffering from periodontitis, and from one random bleeding site per quadrant in healthy groups. Clinical parameters like plaque index (PI), gingival index (GI), pocket depth (PD) and clinical loss of attachment (CAL) were recorded. Viral Deoxyribonucleic acid (DNA) was extracted using Proteinase-K DNA Extraction method, and the presence of CMV and EBV-1 was detected by polymerase chain reaction and 2% agarose gel.
Results: Results of our study showed a 45% prevalence of CMV and EBV-1 in Aggressive periodontitis cases. Prevalence of CMV in chronic periodontitis and healthy subjects was 20% and 10%, respectively; while for EBV-1 it was 25% and 0%, respectively. In terms of comparison of the clinical parameters with virus presence, both CMV and EBV-1 positive sites showed a significantly higher mean pocket depth compared to virus negative sites.
Conclusion: Our studyshowed that the prevalence of EBV1 was higher in chronic and aggressive periodontitis subjects compared to controls and the prevalence of CMV was higher in aggressive periodontitis patients. The virus positive sites showed higher pocket depth compared to virus negative sites. Keywords: Cytomegalovirus, Epsteinbarr virus, polymerase chain reaction, periodontitis, pocket depth
How to cite this article:
Sharma R, Padmalatha O, Kaarthikeyan G, Jayakumar N D, Varghese S, Sherif K. Comparative analysis of presence of Cytomegalovirus (CMV) and Epsteinbarr virus -1 (EBV-1) in cases of chronic periodontitis and aggressive periodontitis with controls. Indian J Dent Res 2012;23:454-8 |
How to cite this URL:
Sharma R, Padmalatha O, Kaarthikeyan G, Jayakumar N D, Varghese S, Sherif K. Comparative analysis of presence of Cytomegalovirus (CMV) and Epsteinbarr virus -1 (EBV-1) in cases of chronic periodontitis and aggressive periodontitis with controls. Indian J Dent Res [serial online] 2012 [cited 2023 Mar 28];23:454-8. Available from: https://www.ijdr.in/text.asp?2012/23/4/454/104948 |
Periodontitis is an infectious disease that involves specific bacteria and characteristic humoral and cellular host responses. The host response is characterized by the dense infiltration of T-lymphocytes, B lymphocytes and macrophages in the inflamed connective tissue of the periodontium. The main etiological agents are varied microbial species organized in the form of a biofilm. The composition of biofilm in chronic periodontitis includes Treponemadenticola, Camphlobacter rectus, Aggregatibacteractinomycetemcomitans Porphromonasgingivalis, Tannerella forsythia, Dialisterpneumosintes, Prevotellaintermedia, and Prevotellanigrescens, organized in the form of orange, green, red complexes. [1] Similarly, the major microbes in aggressive periodontitis are Agregatibacteractinomycetemcomitans followed by Porphromonasgingivalis, Tannerella forsythia, Prevotellaintermedia, Prevotellanigrescens. [2] Although the presence of specific gram negative bacteria is essential in initiating and perpetuating the periodontal disease, the bacterial etiology alone cannot explain the clinico-pathologic features seen in the disease. [3]
Recently, the viruses belonging to Herpetoviridae family have been implicated in the pathogenesis of human periodontitis, as these viruses infect a variety of inflammatory cells. [4] The possible pathogenic mechanism of these viruses includes the cytopathic effect of thevirus on immune cells, thereby impairing the local host response, and resulting in an increased virulence of the resident bacterial pathogens. Also, the mechanism involves inducing the release of cytokines and chemokines from inflammatory and connective tissue cells. [5],[6] In the past decade, herpes virus has been implicated in the etiopathogensis of destructive periodontal disease. The role these viruses play in the etiopathogenesis of periodontal diseases may help in formulating the therapeutic management of periodontitis. [7] Although human Cytomegalovirus (CMV) appears to be of more importance in periodontal disease, Epsteinbarr virus (EBV) may also contribute unique pathogenic properties to the development of the disease. [8],[9] Dual infection hypothesis has also been proposed and it puts forth that dual viral infections seem to be particularly pathogenic and they may accentuate bacterial virulence factors. [10] Hence, the aim of the present study was to evaluate the presence of EBV and CMV virus in sub gingival plaque of chronic periodontitis patients (group A), aggressive periodontitis patients (group B), periodontally healthy controls (group C) and to compare the clinical parameters between the virus negative and positive sites in each of these groups.
| Materials and Methods | |  |
This study was conducted in the Department of Periodontics, Saveetha Dental College, Chennai, India, and was approved by the Ethical Committee of Saveetha University.
Study population
The subjects were selected from the outpatient department of Periodontics, Saveetha Dental College. Subjects were divided into three groups. Group A: Healthy controls, Group B: Chronic Periodontitis, Group C: Aggressive periodontitis, each group consisting of 20 subjects. Inclusion criteria for control group were: subject should be between age of 20-45 years, systemically healthy and have clinically healthy gingiva or simple gingivitis (gingival index score 0.0-1.0).Periodontitis subjects were stratified into chronic (group B) and aggressive periodontitis group (group C) based on the criteria of American Academy of Periodontology (AAP) 1999. The subjects with history of periodontal treatment within the past 6 months, using any medication, smokers, pregnant and lactating mothers and with history of any viral infection in past 6 months were excluded from the study.The study protocol was explained to each subject and informed consent was obtained. Clinical parameters observed included: Gingival Index (GI - Loe and Silness1963), Plaque Index (PI - Silness and Loe1964), Probing pocket depth (PD) and Clinical Attachment loss (CAL). After removal of the supragingival plaque, the sites were dried with air and isolated from saliva contamination using cotton rolls. Sub gingival plaque was collected from 3 periodontitis sites in case of group B and group C, using a sterile Hu Friedy curette. The sample was collected from one random bleeding site per quadrant in control group (group A).
Viral Deoxyribonucleic acid (DNA) was extracted using standardized"PROTEINASE - K" DNA Extraction method. Specific primer sequence was used for detection of strains of CMVand EBV. Primer Sequence for CMV (IEgene, 231 basepairs) Forward Primer 5′ACGTCAGAGGGATCCGATGAACGTCG3′ and Reverse Primer 5′GTCATGTGGAGAAACCGCCGTTCGG 3′.Primer sequence for EBV-1 (EBVNA gene, 500 base pairs) Forward Primer 5′ CTCAGCGCAGGGATGCCCTGGG3′ and ReversePrimer 5′ TGGTGCTGCTGGGGCAA 3′ were used. Following DNA extraction and primer reconstitution, viral DNA was amplified by polymerase chain reaction (PCR)methodology using an In vitro gen kit. PCR was performed with a final volume of 25 μl mixture containing 25 pmol of each primer, 1 U Taq DNA polymerase, magnesium chloride (MgCl 2 ), 0.05 mMDeoxynucleoside triphosphates (dNTP) mix and 1-10 μl of extracted DNA sample.Amplified mix was subjected to electrophoretic separation in TrisEthylenediaminetetraacetic acid (EDTA) in 2% Agarose gel and viewed under transilluminator and gel documentation system as shown in [Figure 1] and [Figure 2].
Statistical analysis
The data was analyzed for obtaining the prevalence using Statistical Package for Social Sciences (SPSS) 2002 Version. Using Likelyhood ratio, chi square value was calculated. Group wise comparison was done using Fisher's Exact test using EPI INFO 2002 System.The difference in the prevalence of CMV and EBV between the three groups was tested pair-wise using Fisher's Exact test. Independent t-test was used for testing the difference in the means between two subgroups for clinical variables.
| Results | | |
The results of this study showed 45% prevalence of CMV in Aggressive periodontitis cases.The prevalence of CMV in Chronic periodontitis and healthy subjects was 20% and 10%, respectively. Using likelihood ratio, Chi square was calculated as 6.93 with P value of 0.03, which was statistically significant. Fisher's Exact test was used to find any group wise associations for virus prevalence between the 3 study groups. Our study result showed significantly higher prevalence of CMV in Aggressive periodontitis group in comparison to healthy group (chi square 6.14; P = 0.01) as shown in [Table 1]. | Table 1: Descriptive statistics for the 3 experimental groups in the study
Click here to view |
In this study, there was a 45% prevalence of EBV-1 in Aggressive periodontitis cases. The prevalence of EBV-1 in Chronic periodontitis and healthy subjects was 25% and 0%, respectively. Using likelihood ratio, chi square was calculated as 15.17 with P value of 0.001, which was statistically significant. The present study result showed significantly higher prevalence of EBV-1 in Aggressive periodontitis group in comparison to healthy group (chi square 11.61; P = 0.00). A higher prevalence of EBV-1 was observed in chronic cases as compared to the healthy cases (chi square 5.7; P = 0.02).
On comparison of the clinical parameters between the CMV positive and negative sites, there was a significantly higher mean sample site plaque index (P = 0.01), gingival index (P = 0.07) in healthy controls as shown in [Table 2]. For Group B, Virus positive sites showed a significantly higher mean pocket depth. No significant association was observed between the presence of virus and loss of attachment, gingival index and Plaque index. For Group C, Virus positive sites showed a significantly higher mean pocket depth. The difference between the two was statistically significant at 0.001 as shown in [Table 3]. In Group A, EBV-1 was not detected in the healthy group, whereas in Group B, Virus positive sites showed a significantly higher mean pocket depth. For Group C, Virus positive sites showed a significantly higher mean pocket depth. No significant association was observed between the presence of virus and loss of attachment, gingival index and Plaque index. | Table 2: Mean ± Standard Deviationof clinical variables by Group and Cytomegalovirus status
Click here to view |
 | Table 3: Mean ± Standard Deviationof clinical variables by Group and Epsteinbarr virus status
Click here to view |
| Discussion | | |
Periodontitis is a disease attributable to multiple infectious agents and interconnected cellular and humoral host immune responses. The bacterial etiology alone fails to explain all features of different types of periodontitis. [1] Hence, an attempt has been made to study and compare the prevalence of CMV and EBV-1 in patients with healthy periodontium with those suffering fromchronic and aggressive periodontitis, and their association with clinical parameters.Subjects with a history of viral infection in the past 6 months were excluded from the study to prevent false positive results in the observations. Tobacco products may interact with and possibly reactivate periodontal herpes virus. Hence, smokers were excluded from the study. [11],[12] In this study, we detected a significantly higher prevalence of CMV (45%) and EBV - 1 (45%) in aggressive periodontitis group as compared to the healthy group. The difference in prevalence for CMV between aggressive and healthy group was statistically significant (P value 0.01).
Similarly, a higher prevalence of EBV-1 was observed in the groups with aggressive (45%) and chronic (25%) periodontitis. The difference in prevalence for EBV-1 between aggressive and healthy group (P = 0.000) and between chronic and healthy group (P = 0.02) was statistically significant. Although, the results showed a higher prevalence of CMV in chronic group (20%) as compared to healthy group (10%), the difference was not statistically significant (P value 0.3).The current study results are in accordance with the previous observations by Parra and Slots, [13] who also reported a higher prevalence of human herpes virus in advanced periodontitis cases, finding CMV in 60% and EBV in 30% of their subjects Studies by Kamma et al. examined the occurrence of these viruses in patients with aggressive periodontitis and observed a statistically significant higher occurrence of CMV (59%) and EBV - 1 (43.8%) in disease active sites in comparison to healthy subjects (12.5%). [14] In Chinese population, Wu et al. (2005) detected a higher prevalence of EBV - 1in chronic periodontitis (29%) as compared tohealthy subjects (15%) The present study results for EBV-1 (25%) are similar to the above mentioned study. [15]
Both CMV and EBV-1 virus positive sites were found to have a significantly higher pocket depth in both the chronic and aggressive periodontitis groups. Although higher values were seen in terms of CAL and PI in virus positive sites, it was not statistically significant. The higher pocket depth in CMV and EBV positive sites indicates that these viruses might have helped specific bacterial colonization leading to greater disease severity.
Contreras et al. also observed increased pocket depth at the sampled sites, especially in virus positive patients of chronic and aggressive periodontitis groups. Their study showed a statistically significant association between CAL andvirus presence. [16] In this study, we did not find any significant association between the presence of virus and CAL (P value of 0.61). However, in a study by Ling et al. which compared the disease severity in terms of clinical parameters (GI, PI, CAL, PD) with virus isolation, there was no statistically significant association found between the presence of CMV andany of the clinical parameters. [17] Interestingly, our results also lead to the observation that in the aggressive periodontitis group, of the nine EBV-1 positive subjects, six were positive for CMV as well. In the group with chronic periodontitis, of the five EBV-1 positive samples, two were positive for CMV as well. This observation may lend support to the dual infection hypothesis which puts forth that dual viral infections seem to be particularly pathogenic and may accentuate bacterial virulence factors. [10]
In the healthy group, this study results showed a significant association between a high plaque index with CMV isolation (P = 0. 01). A study by Saygun, Yaper et al. also compared clinical parameters with virus isolation and found statistically significant association in terms of PI (P = 0.035) and GI (P = 0.024). [18],[19],[20] Similar to the present study, their study also showed no statistically significant difference among the other parameters in healthy groups.Since CMV resides in monocytes, macrophages and T cells, and EBV in B cells, dual infection by these viruses has the potential to impair major defense mechanisms of the periodontium. Recent study by Botero, Contreras et al. showed the presence of CMV infection in 53.3% of the periodontally diseased subjects. Nevertheless, similar to our study, periodontally healthy subjects also were positive for CMV in a proportion of 18.1%. This study results showed 10% prevalence of CMV in the healthy group alone. It is considered that CMV is acquired frequently at an early age and the prevalence in the general population increases at the age of 30 - 35 years. This may explain its presence in the sub - gingival space of healthy subjects. [21] However, a higher prevalence in periodontally diseased sites may reflect a viral reactivation in the pathological conditions.
The role these viruses play in theetiopathogenesis of periodontitis is important to learn, and may help to understand better about its therapeutic management. Recently, a report showed that there was a marked improvement in the periodontal parameters after treating the patient with antiviral therapy (Valtrex® for a period of 10 days). This report suggests that virus screening and subsequent antiviral therapy may be useful as an adjunct to conventional periodontal therapy. [7]
| Conclusion | | |
This study concludes that there is a higher prevalence of both CMV and EBV-1 in Aggressive Periodontitis cases, and higher prevalence of CMV in cases of chronic periodontitis. There was a significant correlation between the presence of CMV and EBV-1 virusand the pocket depth.
| References | | |
| 1. | Haffajee AD, Socransky SS.Microbiology of periodontal diseases.Periodontol 2000 2005;38:9-12. 
|
| 2. | Mestnik MJ, Feres M, Figueiredo LC, Duarte PM, Lira EA, Faveri M. Short-term benefits of the adjunctive use of metronidazole plus amoxicillin in the microbial profile and in the clinical parameters of subjects with generalized aggressive periodontitis. J ClinPeriodontol 2010;37:353-65.
[PUBMED] |
| 3. | Slots J, Kamma J, Sugar C. The herpes virus- Porphromonasgingivalis -periodontitis axis. J Periodontal Res 2003;38:318-23.
|
| 4. | Contreras A, Slots J. Herpesviruses in human periodontal disease. Periodontol Res 2000;35:3-16.
[PUBMED] |
| 5. | Bale JF. Effect of CMV on murine neutrophil migratory and phagocytic activities. J Biol1985;38;723-34.
|
| 6. | Banks TA, Rouse BT. Herpesviruses - Immune escape artists? Clin Infect Dis 1992;14:933-41.
|
| 7. | Sundea PT, Olsena I, Enersena M, Grindea B. Patient with severe periodontitis and subgingival Epstein-Barr virus treated with antiviral therapy. J ClinVirol 2008;42:176-8.
|
| 8. | Slots J, Saygun I, Sabeti M, Kubar A. Epstein Barr in oral disease J Periodontal Res 2006;41:235-44.
|
| 9. | Klein G. Viral Latency and transformation: The strategy of Epstein-Barr virus. Cell 1989;58:5-8.
[PUBMED] |
| 10. | Bertram G, Dreiner N, Krueger GR, Ramon A, Ablashi DV, Salahuddin SZ, et al. Frequent double infection with Epstein-Barr virus and human herpesvirus-6 in patients with acute infectious mononucleosis. In vivo 1991;5:271-9.
[PUBMED] |
| 11. | Park NH, Herbosa EG, Sapp JP.Effect of tar condensate from smoking tobacco ad.of mice with latent herpes simples virus. Arch Oral Biol 1987;32:47-53.
[PUBMED] |
| 12. | Tanner A, Goodson JM. Sampling of microorganisms associated with periodontal disease. Oral MicrobiolImmunol 1986;1:15-20.
|
| 13. | Parra B, Slots J. Detection of human virus in periodontal pockets using polymerase chain reaction. Oral MicrobiolImmunol 1996;5:289-93.
|
| 14. | Kamma JJ, Slots J. Herpes viral bacterial interaction in aggressive periodontitis. J ClinPeriodontol 2003;30:420-6.
[PUBMED] |
| 15. | WU Y-M, Chen LL, Yan J. Infection frequency of EBV in subgingival samples from patients with different periodontal status and its correlation with severity of periodontal lesions. Zhonghua Yi XueZaZhi 2005;85:3216-20.
|
| 16. | Botero JE, Parra B, Jaramillo A. Contreras A. Subgingival Human Cytomegalovirus Correlates With Increased Clinical Periodontal Parameters and Bacterial Coinfection in Periodontitis. J Periodontol 2007;78:2303-10.
|
| 17. | Ling LJ, Ho CC, Wu CY, Chen YT, Hing SL. Association between human herpes virus and the severity of periodontitis. J Periodontol 2004;75:1479-85.
|
| 18. | Saygun I, Sermet S, Özdemir A, Kurtiº B, Yapar M, Kubar A, et al. Detection of human herpes virus HCMV, EBV, HSV in patients with chronic periodontitis and relationship between virus and clinical parameters. J Periodontol 2002;73:1437-43.
|
| 19. | Yapar M, Saygun I, Ozdemir A, Kubar A, Sahin S. Prevalence of human herpesviruses in patients with aggressive periodontitis. J Periodontol 2003;74:1634-40.
[PUBMED] |
| 20. | Kubar A, Saygun I, Ozdemir A, Yapar M, Slots J. Real time PCR quantification of human cytomegalovirus and EBV in periodontal pockets and adjacent gingival of periodontitis lesions. J Periodontal Res2005;40:97-104.
[PUBMED] |
| 21. | Slots J. Update on human cytomegalovirus in destructive periodontal disease. Oral MicrobiolImmunol 2004;19:217-23.
[PUBMED] |
Correspondence Address:
Ogoti Padmalatha
Department of Periodontics, Saveetha Dental College and Hospitals, Chennai
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0970-9290.104948
[Figure 1], [Figure 2]
[Table 1], [Table 2], [Table 3] |
|
| This article has been cited by | | 1 |
RARE COMBINATION OF COMPLICATIONS FROM CYTOMEGALOVIRUS INFECTION IN AN IMMUNOCOMPETENT PATIENT - ACUTE SENSORY ATAXIC NEUROPATHY, HEPATITIS, PERIODONTITIS AND RASH |
|
| Kalyvas Athanasios-Christos, Natsis Konstantinos, Theochari Evangelia, Papastogiannis Tsampikos, Papamichalis Evangelos, Kourtesi Georgia | | Neuroimmunology Reports. 2022; : 100126 | | [Pubmed] | [DOI] | | | 2 |
Association between Epstein-Barr virus and periodontitis: A meta-analysis |
|
| Chaerita Maulani, Elza Ibrahim Auerkari, Sri Lelyati C. Masulili, Yuniarti Soeroso, Widayat Djoko Santoso, Lindawati S. Kusdhany, Peter Eickholz | | PLOS ONE. 2021; 16(10): e0258109 | | [Pubmed] | [DOI] | | | 3 |
Role of Periodontal Bacteria, Viruses, and Placental mir155 in Chronic Periodontitis and Preeclampsia—A Genetic Microbiological Study |
|
| Jaideep Mahendra, Little Mahendra, Maryam H. Mugri, Mohammed E. Sayed, Shilpa Bhandi, Rahaf Turki Alshahrani, Thodur Madapusi Balaji, Saranya Varadarajan, Swetha Tanneeru, Abirami Nayaki Rao P., Sruthi Srinivasan, Rodolfo Reda, Luca Testarelli, Shankargouda Patil | | Current Issues in Molecular Biology. 2021; 43(2): 831 | | [Pubmed] | [DOI] | | | 4 |
Detection of Epstein–Barr Virus in Periodontitis: A Review of Methodological Approaches |
|
| Lilit Tonoyan, Marlène Chevalier, Séverine Vincent-Bugnas, Robert Marsault, Alain Doglio | | Microorganisms. 2020; 9(1): 72 | | [Pubmed] | [DOI] | | | 5 |
Evaluation of the antiherpetic activity of toothpaste with herbal ingredients and rinses in the treatment of chronic generalized periodontitis |
|
| M. E. Malyshev, A. A. Petrov, A. K. Iordanishvili | | Parodontologiya. 2020; 25(2): 141 | | [Pubmed] | [DOI] | | | 6 |
Periodontitis and Cytomegalovirus Associate With Atherosclerosis Among HIV Patients After 5 Years on ART |
|
| Endah A. T. Wulandari, Ika Prasetya Wijaya, Birry Karim, Ibnu Ariyanto, Selita Agnes Tanudjaja, Silvia Lee, Patricia Price | | JAIDS Journal of Acquired Immune Deficiency Syndromes. 2020; 85(2): 195 | | [Pubmed] | [DOI] | | | 7 |
Detection rates of periodontal bacteria and herpesviruses in different forms of periodontal disease |
|
| Miljan Puletic, Branka Popovic, Sasa Jankovic, Gavrilo Brajovic | | Microbiology and Immunology. 2020; 64(12): 815 | | [Pubmed] | [DOI] | | | 8 |
Relationship between herpesviruses and periodontal disease progression |
|
| Pinar Emecen-Huja, Robert J. Danaher, Dolphus R. Dawson, Chunmei Wang, Richard J. Kryscio, Jeffrey L. Ebersole, Craig S. Miller | | Journal of Clinical Periodontology. 2020; 47(4): 442 | | [Pubmed] | [DOI] | | | 9 |
Association between human cytomegalovirus and periodontitis: A systematic review and meta-analysis |
|
| Javier Enrique Botero, Carolina Rodríguez-Medina, Adriana Jaramillo-Echeverry, Adolfo Contreras | | Journal of Periodontal Research. 2020; 55(4): 551 | | [Pubmed] | [DOI] | | | 10 |
Intérêt de l’échographie abdominale pour l’analyse des vidanges, des reflux et de la tonicité gastro-duodéno-jéjuno-iléale |
|
| Bruno Donatini | | Hegel. 2019; N° 3(3): 196 | | [Pubmed] | [DOI] | | | 11 |
Herpesviruses in etiopathogenesis of aggressive periodontitis: A meta-analysis based on case-control studies |
|
| Fei Li,Ce Zhu,Feng-Ying Deng,May. Chun. Mei Wong,Hai-Xia Lu,Xi-Ping Feng,Bruno Verhasselt | | PLOS ONE. 2017; 12(10): e0186373 | | [Pubmed] | [DOI] | | | 12 |
Herpesviruses in etiopathogenesis of aggressive periodontitis: A meta-analysis based on case-control studies |
|
| Fei Li,Ce Zhu,Feng-Ying Deng,May. Chun. Mei Wong,Hai-Xia Lu,Xi-Ping Feng,Bruno Verhasselt | | PLOS ONE. 2017; 12(10): e0186373 | | [Pubmed] | [DOI] | | | 13 |
Epstein–Barr virus is associated with periodontal diseases |
|
| Zilong Gao, Juan Lv, Min Wang | | Medicine. 2017; 96(6): e5980 | | [Pubmed] | [DOI] | | | 14 |
Association between human herpes virus and aggressive periodontitis: A systematic review |
|
| Ahmed Abdullah Alzahrani | | The Saudi Journal for Dental Research. 2017; 8(1-2): 97 | | [Pubmed] | [DOI] | | | 15 |
Association between human herpes virus and aggressive periodontitis: A systematic review |
|
| Ahmed Abdullah Alzahrani | | The Saudi Journal for Dental Research. 2017; 8(1-2): 97 | | [Pubmed] | [DOI] | | | 16 |
Putative periodontopathic bacteria and herpesviruses in pregnant women: a case-control study |
|
| Haixia Lu,Ce Zhu,Fei Li,Wei Xu,Danying Tao,Xiping Feng | | Scientific Reports. 2016; 6(1) | | [Pubmed] | [DOI] | | | 17 |
Putative periodontopathic bacteria and herpesviruses in pregnant women: a case-control study |
|
| Haixia Lu,Ce Zhu,Fei Li,Wei Xu,Danying Tao,Xiping Feng | | Scientific Reports. 2016; 6(1) | | [Pubmed] | [DOI] | | | 18 |
Viral serological and molecular data on possible involvement of herpes viruses in periodontal disease |
|
| Cristiana Antipa,Coralia Bleotu,Camelia Grancea,Andreea Oana Rosu,Gabriela Anton,Simona Ruta | | Singapore Dental Journal. 2016; 37: 15 | | [Pubmed] | [DOI] | | | 19 |
Viral serological and molecular data on possible involvement of herpes viruses in periodontal disease |
|
| Cristiana Antipa,Coralia Bleotu,Camelia Grancea,Andreea Oana Rosu,Gabriela Anton,Simona Ruta | | Singapore Dental Journal. 2016; 37: 15 | | [Pubmed] | [DOI] | | | 20 |
Role of herpes viruses in periodontal disease pathogenesis |
|
| A. I. Shatokhin,E. V. Volchkova | | Stomatologiya. 2016; 95(2): 89 | | [Pubmed] | [DOI] | | | 21 |
Role of herpes viruses in periodontal disease pathogenesis |
|
| A. I. Shatokhin,E. V. Volchkova | | Stomatologiya. 2016; 95(2): 89 | | [Pubmed] | [DOI] | | | 22 |
Detection of EBV, CMV and HSV-1 in subgingival samples of HIV positive and negative patients with chronic periodontitis. |
|
| Laura Escalona,Dayahindara Veitía,María Correnti | | Journal of Oral Research. 2016; 5(4): 168 | | [Pubmed] | [DOI] | | | 23 |
Mycobacterium avium Paratuberculosis (MAP) and Cytomegalovirus (CMV) Are Frequently Detected in the Saliva of Patients Recently Diagnosed with Crohn Disease (CD) Whereas Oral Propionibacterium Acnes (PA) or Methylacetate (MA) in Their Breath Is Rare |
|
| Donatini Bruno,Le Blaye Isabelle | | Journal of Biosciences and Medicines. 2015; 03(12): 13 | | [Pubmed] | [DOI] | | | 24 |
Mycobacterium avium Paratuberculosis (MAP) and Cytomegalovirus (CMV) Are Frequently Detected in the Saliva of Patients Recently Diagnosed with Crohn Disease (CD) Whereas Oral Propionibacterium Acnes (PA) or Methylacetate (MA) in Their Breath Is Rare |
|
| Donatini Bruno,Le Blaye Isabelle | | Journal of Biosciences and Medicines. 2015; 03(12): 13 | | [Pubmed] | [DOI] | | | 25 |
Prevalence of Herpesvirus and Correlation with Clinical Parameters in Indian Subjects with Chronic Periodontitis |
|
| Vinayak Mahableshwar Joshi, Kishore Gajanan Bhat, Sandeep Suresh Katti, Manohar Suresh Kugaji, Preeti Shivaji Ingalgi | | The Journal of Contemporary Dental Practice. 2015; 16(11): 915 | | [Pubmed] | [DOI] | | | 26 |
Association between Herpesviruses and Chronic Periodontitis: A Meta-Analysis Based on Case-Control Studies |
|
| Ce Zhu,Fei Li,May. Chun. Mei Wong,Xi-Ping Feng,Hai-Xia Lu,Wei Xu,Luwen Zhang | | PLOS ONE. 2015; 10(12): e0144319 | | [Pubmed] | [DOI] | | | 27 |
Association between Herpesviruses and Chronic Periodontitis: A Meta-Analysis Based on Case-Control Studies |
|
| Ce Zhu,Fei Li,May. Chun. Mei Wong,Xi-Ping Feng,Hai-Xia Lu,Wei Xu,Luwen Zhang | | PLOS ONE. 2015; 10(12): e0144319 | | [Pubmed] | [DOI] | | | 28 |
Periodontal herpesviruses: prevalence, pathogenicity, systemic risk |
|
| Jørgen Slots | | Periodontology 2000. 2015; 69(1): 28 | | [Pubmed] | [DOI] | | | 29 |
Periodontal herpesviruses: prevalence, pathogenicity, systemic risk |
|
| Jørgen Slots | | Periodontology 2000. 2015; 69(1): 28 | | [Pubmed] | [DOI] | | | 30 |
Altered Oral Viral Ecology in Association with Periodontal Disease |
|
| Melissa Ly,Shira R. Abeles,Tobias K. Boehm,Refugio Robles-Sikisaka,Mayuri Naidu,Tasha Santiago-Rodriguez,David T. Pride,Martin J. Blaser | | mBio. 2014; 5(3) | | [Pubmed] | [DOI] | | | 31 |
Altered Oral Viral Ecology in Association with Periodontal Disease |
|
| Melissa Ly,Shira R. Abeles,Tobias K. Boehm,Refugio Robles-Sikisaka,Mayuri Naidu,Tasha Santiago-Rodriguez,David T. Pride,Martin J. Blaser | | mBio. 2014; 5(3) | | [Pubmed] | [DOI] | |
|
|
|
|
|
|
|
|
|
|
|
|
| Article Access Statistics | | | Viewed | 7929 | | | Printed | 520 | | | Emailed | 1 | | | PDF Downloaded | 224 | | | Comments | [Add] | | | Cited by others | 31 | | |
|
|
Users online:
