 Abstract | | |
Background: Dental caries is a chronic and multifactorial disease mainly caused by microorganisms that are accumulated on soft and hard tissues of oral cavity. Lactobacillus is one of that kind, produces acid after metabolic breakdown of dietary sugar and reduces the pH of oral environment, resulting in teeth demineralisation or dental caries. Aim: The present study focuses on the distribution and characterisation of lactobacilli in the oral cavity of children which are associated with dental caries formation. Methods: Total 116 swab samples were collected from different age groups of children by swabbing the caries surface of teeth. Physiological, morphological and biochemical characteristics of Lactobacillus were analysed. Whole cell protein profiling using SDS-PAGE was also performed for their characterisation. Molecular characterisation of selected isolates was done using 16S-rRNA sequencing for identification. Results: Total 269 isolates were successfully isolated and identified by physiological and biochemical tests according to Bergey's Manual Systematic Bacteriology, which belongs to the seven species of Lactobacillus i.e., L. acidophilus, L. casei, L. delbrueckii, L. helveticus, L. plantarum, L. rhamnosus, L. salivarius. All the isolates were further differentiated by whole cell proteins profiling and species level identification was done by 16S-rRNA gene sequencing method. Conclusions: The present study, suggested that the occurrence of the species of Lactobacillus changes with the age of the individual, but L. rhamnosus (20.54%) and L. acidophilus (18.21%) were abundantly found in age group of 3-12 yr which could be the possible causative agent of dental caries formation in the children of Central India.
Keywords: Dental caries, Lactobacillus, oral cavity, SDS-PAGE and 16S-rRNA gene sequencing
How to cite this article:
Ahirwar SS, Snehi SK, Gupta M K. Distribution and molecular characterisation of Lactobacilli in the oral cavity of children. Indian J Dent Res 2021;32:8-14 |
How to cite this URL:
Ahirwar SS, Snehi SK, Gupta M K. Distribution and molecular characterisation of Lactobacilli in the oral cavity of children. Indian J Dent Res [serial online] 2021 [cited 2023 Mar 26];32:8-14. Available from: https://www.ijdr.in/text.asp?2021/32/1/8/321369 |
| Introduction | |  |
Dental caries is a chronic and multifactorial disease caused by microorganisms and some environmental factors.[1] It is the most prevalent disease worldwide, according to World Health Organization (WHO), around 60–90% school children are affected from dental caries in the developing countries and about half of the world population (3.58 billion people) have dental caries in their permanent teeth.[2],[3] Dental caries affected all the age groups and has become more common in both children and adults in the recent year. The scenario of dental caries in India does not differ from other developing countries; it is highly prevalent and severe in indigenous communities of India.[4] A recent study suggests that one out of two children in India is affected by dental caries and there can be increase in caries burden in the future.[5] In order to decrease the prevalence of caries, an improved understanding of the role of the microorganisms in dental diseases is needed.[6] Previous studies suggested that Streptococcus mutans and Lactobacilli are the main etiological agent of dental caries formation.[7],[8] Most of the studies reported that S. mutans is the initiator of dental caries but some of the studies suggest that bacterial species other than S. mutans e.g., Lactobacillus and Actinomyces, likely play important role in the caries process.[6],[8] Basically, Lactobacillus is the safe grade bacteria but in the oral cavity it has been associated with dental caries from over a century back and plays an important role in dental caries formation.[9],[10] Lactobacillus is highly acidogenic in the presence of carbohydrates and they can tolerate pH at 3.0. Acid production, biofilm formation and acid tolerance properties of Lactobacillus are the enemies of the teeth.[11] When the count of Lactobacillus in saliva reaches at level ≥105 it is critical for dental caries formation.[12],[13] Lactobacillus is a diverse group of bacteria with over 80 known species, one-fourth of total identified species reported in the oral cavity but still, it is not confirmed that which species of Lactobacillus directly associated with dental caries.[14] The present study deals with isolation, characterisation, identification and protein profiling of Lactobacillus species which are found on the caries surface of the teeth of children.
| Methods and Methodology | | |
The present study conducted in children belonging to age group of 3 to 12 years. The study was approved by Research Development Committee (RDC) of Barkatullah University Bhopal (M.P.) India and Institutional Ethical Committee (Ref. MIS/2015/01/MICRO/01) of People's Dental Academy Bhopal (M.P.) India. Total of 116 samples were collected with prior consent from People's Dental Academy Bhopal (M.P.) India.
Sample collection
Samples were collected from children by swabbing teeth over the caries surface. The swab was immediately placed into a pre-labelled glass tube containing 5 ml of 0.8 NaCl Solution. Bacterial sample was removed from the swabs by shaking the swab vigorously for 30 sec in the medium; the swab was then discarded. The bacterial samples were transported in ice to the microbiology laboratory within 2 hr for processing.
Sample processing
All samples were rotated properly by using vortex 30s. A 100-fold dilution of sample was obtained using saline. 0.5 ml was transferred to De Man, Rogosa and Sharpe (MRS) Agar Medium (HiMedia, India). MRS agar plates were kept in an anaerobic jar using gas pack for 48 hr. Colonies were identified by morphological characteristics and Gram's staining.
Biochemical characterisation
Lactobacilli were characterised using biochemical tests like citrate, catalase, arginine, hydrolysis tests, etc., Various sugar i.e., mannitol, mannose, ribose, arabinose, fructose, salicine, sorbitol, trehlose, sucrose, xylose etc., used for carbohydrate fermentation tests.[15]
Whole cell protein extraction
Bacterial whole cell proteins were extracted using previously described method[16],[17],[18] with some modifications. Pure culture of lactobacilli was inoculated in 20 ml MRS broth at 37°C for 24 hr, supplemented with 1% L-arginine (Hi-media, India) to delay autolysis. Cells from 20 ml of culture were harvested by centrifugation (7,000 × g); pellets were recovered and washed twice with PBS (Phosphate Buffer Saline) for removal of excess amount of MRS broth, and recentrifuged (10,000 × g). Bacterial cells then resuspended in 10 ml ice-cold acetone, allowed to withstand for 10 min, and collected by centrifugation (7,000 × g). The proteins were then extracted by incubating with 1.0 ml of 1% Sodium Dodecyl Sulfate (SDS) and stored at –20°C. Obtained whole cell proteins were quantified using Lowry's Method.[19]
Sodium dodecyl sulfate polyacrylamide gel electrophoresis
Cell free extracts of proteins were subjected to SDS-PAGE on vertical slabs gel according to Laemmli.[20] Polyacrylamide gels were composed of 12% resolving gel and 5% stacking gel. The electrode buffer was 0.3% mM Tris, 1.44% mM glycine, 0.1% (w/v) SDS (pH 8.3). A volume of sample containing 40 μg of proteins and 40 μl of loading sample buffer [0.01% (w/v) Bromophenol blue, 2% (w/v) SDS in buffer phosphate 1M (pH 6.8)] was mixed and heated at 95°C for 5 min. then allowed to cool down, at room temperature followed by loading in wells on top of the gel. Electrophoresis was performed at current of 50 mA and 120 V. Gel was stained overnight in coomassie blue stain [0.25% (w/v) coomassie blue, 50% (v/v) methanol and 10% (v/v) acetic acid]. The excess stain was washed out by destaining the gel with a solution of 25% (v/v) methanol and 10% (v/v) acetic acid.
Molecular characterisation
Genomic DNA extraction
Bacterial DNA was extracted using the phenol: chloroform method.[21] Cultures of the seven selected species of Lactobacillus were grown in broth and centrifuged at 10,000 × g for 10 min. to sediment the bacteria. The pellets were washed in 1 ml phosphate buffer saline (PBS) and centrifuged again. DNA samples were dissolved in Trisacetate- Ethylenediaminetetraacetic acid (Tris-EDTA), buffer (HCl 10 mM Tris, 1 mM EDTA, pH = 7.4), and DNA concentration was determined by UV spectrophotometer. Obtained DNAs were stored at -20°C for further study.
PCR amplification of 16S-rRNA gene and electrophoresis
The 16S-rRNA gene was amplified by PCR using primers, forward (5′ AGAGTTTGATCCTGGCTCAG 3′) and reverse (5′ GGTTACCTTGTTACGACTT 3′) (Srinivasan et al. 2015).[22] Expected size of the amplified fragment ̃1500 bp. Template DNA was diluted to the concentration range of 20-50 ng/μL. The PCR master mix was prepared for total reaction volume of 20 μL by adding the 14.2 μL nuclease free water, 2.0 μL Taq polymerase assay buffer, 0.5 μL MgCl2, 0.5 μL dNTPs, 0.5 μL of each primer (Sigma Aldrich, USA), 0.2 μL Taq DNA polymerase (Thermo Scientific, USA), and 1 μL DNA template. The following PCR conditions were used for amplification of 16S-rRNA gene: initial denaturation at 94°C for 5 min; 35 cycles of 94°C for 1 min, 52°C for 30 sec and 72°C for 1 min 40 sec; and a final extension step at 72°C for 10 min. The PCR amplified products were run by gel electrophoresis with a 0.8% agarose gel, at 80 V for 25 min. The agarose gel was prepared in 1X Sodium borate buffer and samples were run with 1kb DNA ladder as a molecular marker. The gel was then stained in Ethidium Bromide for 20–30 min., visualized under UV trans-illuminators and documented using Gel Documentation System (Bio-Rad, USA).
16s-rRNA gene sequencing
Obtained PCR product was sent to Indian Institute of Science Education and Research, Bhopal (M.P.) India for analysis of 16S-rRNA gene sequencing. The raw 16S-rRNA gene sequences were obtained in the ABI format and edited using Chromas-Pro software version 2.0.1.
Phylogenetic analysis
The edited gene sequences were then identified and compared for homologies in the BLASTn database with GenBank (National Center for Biotechnology Information) using the basic local alignment search tool (BLAST). MEGA version 7.0 software was used to create phylogenetic trees based on the neighbour-joining (NJ) method. All bacterial 16S-rRNA gene sequences were deposited in GenBank.
| Results | | |
This study conducted in individuals belong to the age group of 3–12 yrs. Total of 116 individuals participated in the present study which had active dental caries in their teeth. The swab samples were collected from the surface of dental caries from each individual [Table 1].
After incubation of each sample on MRS agar media, colonies, different in colour, shape and size were re-cultured to obtain a pure culture. Isolates, which gave Gram's positive reaction, catalase negative, appears non-motile, negative citrate test were selected for further study. Carbohydrate fermentation test was used for primary screening and differentiation of Lactobacilli. Total 269 isolates were confirmed as the members of genus Lactobacillus using biochemical and sugar fermentation tests [Table 2] and [Figure 1]. | Figure 1: Lactobacillus species isolated from caries surface of different age group of children
Click here to view |
Proteins profiling of Lactobacillus species
Proteins profiling of all isolates were done using the SDS-PAGE method. Each isolates gave different protein banding pattern in electrophoregram. Electrophoregram of isolates are given in [Figure 2], [Figure 3], [Figure 4], [Figure 5]. Total 247 isolates were differentiated by SDS-PAGE which belong to the seven groups on the basis of electrophoregram and banding patterns of whole cell proteins i.e., Group I (L. rhamnosus) n = 53, Group II (L. casei) n = 35, Group III (L. plantarum) n = 37, Group IV (L. salivarius) n = 31, Group V (L. delbrueckii) n = 24, Group VI (L. acidophilus) n = 44 and Group VII (L. helveticus) n = 23 [Table 3]. Obtained SDS-PAGE results further validated by 16S-rRNA gene sequencing method for confirmation of Lactobacillus species. | Figure 2: Whole cell proteins profile of selected isolates of L. rhamnosus (a) and L. casei (b). Where M = Proteins Weight Marker, RS = Reference strain, S, C = isolated from caries surface of children
Click here to view |
 | Figure 3: Whole-cell proteins profile of selected isolates of L. acidophilus (a) and L. helveticus (b). Where M = Proteins Weight Marker, RS = Reference strain, S, C = isolated from caries surface of children
Click here to view |
 | Figure 4: Whole-cell proteins profile of selected isolates of L. delbrueckii (a) and L. plantarum (b). Where M = Proteins Weight Marker, RS = Reference strain, S, C = isolated from caries surface of children
Click here to view |
 | Figure 5: Whole-cell proteins profile of selected isolates of L. salivarius. Where M = Proteins Weight Marker, RS = Reference strain, S, C = isolated from caries surface of children
Click here to view |
 | Table 3: Species of Lactobacillus primarily identified by carbohydrate fermentation & SDS-PAGE and further validated by 16S-rRNA gene sequencing
Click here to view |
| Identification of lactobacilli by 16S-rRNA Gene Sequencing and validation of Sugar Fermentation and SDS-PAGE results | | |
On the basis of physiological, biochemical and SDS-PAGE results seven isolates of Lactobacillus i.e., S1, S56, S60, S102, S184, S227 and S252 were processed for further molecular characterisation. DNA was extracted from all seven isolates using phenol chloroform method. Purity of extracted DNA was checked by running the sample on 0.8% agarose gel electrophoresis and absorbance at 260-280 nm. The ratio of A260/A280 was found 1.8-1.9 which reflects the purity of genomic DNA. PCR products of selected bacterial strains showed the approximate expected size ̃1500 bp amplicon by using 0.8% agarose gel electrophoresis followed by visualisation under UV light and photographed using gel documentation system.
The obtained 16S-rRNA gene sequences were matched by BLAST in NCBI to check sequences similarity with reference NCBI sequence database. Partial 16S-rRNA gene sequences of selected isolates (under study) S1, S56, S60, S102, S184, S227 and S252 showed close relationship with various species of Lactobacillus, where MG827269 showed close relationship with L. acidophilus, (MG827270) L. helveticus, (MG827272) L. casie, (MG827273) L. plantarum, (MG827277) L. rhamnosus, (MG827292) L. delbrueckii and (MG827302) L. salivarius, respectively. Sequences of the 16S-rRNA genes from new isolates represented different groups and possible new Lactobacillus strains and species were deposited in GenBank (NCBI) with accession numbers MG827269, MG827270, MG827272, MG827273, MG827277, MG827292 and MG827302 [Table 4]. All obtained sequences aligned and phylogenetic tree was constructed [Figure 6], which is showing the genetic relationship among the isolated Lactobacillus strains, based on 16S-rRNA gene sequence variations using MEGA 7.0 software. | Figure 6: Phylogenetic analysis of Lactobacilli on the basis of 16S-rRNA gene sequence, lactobacilli isolated from the surface of dental caries of children. Phylogenetic tree was constructed by MEGA 7.0 software using neighbour joining method. Closely related types and reference strains are shown in parentheses together with accession numbers from GenBank. Cluster I L. casei Group, Cluster II L. rhamnosus Group, Cluster III L. salivarius Group, Cluster IV L. plantarum Group, Cluster V L. delbrueckii Group, Cluster VI L. acidophilus, Cluster VII L. helveticus Group and Cluster VIII Other bacteria
Click here to view |
| Discussion | | |
Dental caries is a multifactorial disease and one of the major health problem in developing country like India, it affects all the age groups of population. The process of dental caries formation is little bit complex. Environmental factors such as oral hygiene, diet and various microorganisms play the main role in its formation.[23] The main cariogenic groups are Streptococcus, Lactobacillus, Actinomyces, Prevotella, Candida, etc.[7],[24],[25] The Streptococci and Lactobacilli are the main acid producer in the oral cavity. They ferment dietary sugar and produce acid as a by-product, which decreases the pH of the oral cavity resulting in the increased population of acid tolerant bacteria. Then aciduric bacteria start to attack on the teeth and produce a thin layer of biofilm and starts tooth decay.[26] Lactobacilli are associated with the dental caries since 20th century; it is the predominant group of bacteria after Streptococci mutans of the oral flora. Lactobacilli are mostly reported in the various sites of oral cavity such as saliva[27],[28],[29],[30],[31] carious lesion[32],[33],[34] etc.
In this study, total of 269 isolates of Lactobacillus were successfully isolated from caries surface, using the culture-dependent method [Figure 1], differentiated by SDS-PAGE and the species level identification was done using 16S-rRNA gene sequencing method. Electrophoregram (SDS-PAGE) of all the isolates gave seven types of banding pattern [Figure 2], [Figure 3], [Figure 4], [Figure 5]. Total of 247 isolates were classified into seven groups by SDS-PAGE [Table 3]. Total seven isolates from all groups (one from each) taken for species level identification using 16S-rRNA gene sequencing. The obtained 16S-rRNA gene sequences were matched by BLAST in NCBI to check sequence similarity with the reference NCBI sequences database. Partial 16S-rRNA gene sequences of selected isolates (under study) S1, S56, S60, S102, S184, S227 and S252 showed close relationship with different species of Lactobacillus, where MG827269 showed close relationship with L. acidophilus, (MG827270) L. helveticus, (MG827272) L. casie, (MG827273) L. plantarum, (MG827277) L. rhamnosus, (MG827292) L. delbrueckii and (MG827302) L. salivarius, respectively [Table 4]. Results of 16S-rRNA gene sequencing, validated biochemical, sugar fermentation and SDS-PAGE results. The technique is used most popularly, for identification of bacterial species at species level.[11],[35],[36],[37]
16S-rRNA gene sequence similarity [Figure 6] & [Table 4] confirmed that all the isolates belong to seven species of Lactobacillus i.e., L. acidophilus, L. casei, L. delbrueckii, L. helveticus, L. plantarum, L. rhamnosus and L. salivarius [Figure 7] and [Table 2], [Table 3]. This is the first study characterizing the various species of Lactobacillus on caries surface because most of the previous caries-related studies were quantitative.[12],[13] | Figure 7: Numbers of species identified by carbohydrate fermentation tests and SDS-PAGE
Click here to view |
Results of the present study suggested that L. rhamnosus (20.54%) and L. acidophilus (18.21%) were the predominant ones reported in each age group. But the ratio of lactobacilli was directly proportional to the increase in age. We observed that L. rhamnosus and L. acidophilus were dominant in age groups of 3-4 year., 6-10 year. group of children, whereas L. rhamnosus and L. casei were abundantly reported in the age group of 5 year. group. Moreover, the percentage of L. acidophilus was reported, higher in the age group of 11-12 year. old children [Figure 1]. The study demonstrated that the percentage of lactobacilli changed with increasing age but L. rhamnosus and L. acidophilus [Figure 8] were found in every age group and could possibly be a causative agent with Streptococcus mutans of dental caries formation.
| Conclusion | | |
Total of 269 isolates were isolated from caries surface of children which belong to seven species of Lactobacillus i.e., L. acidophilus, L. casei, L. delbrueckii, L. helveticus, L. plantarum, L. rhamnosus and L. salivarius. Study concluded that the species of Lactobacillus increase with age of the individuals but L. rhamnosus (20.54%) and L. acidophilus (18.21%) were abundantly found in each age group which could be the possible causative agent of dental caries formation in children of Central India.
Moreover, Lactobacillus helveticus found in this study is not reported before from the caries surface of children.
Financial support and sponsorship
Authors would like to thanks University Grant Commission (New Delhi, India) to provide Rajiv Gandhi National Fellowship for financial support (RGNF-2015-17-SC-MAD-20431).
Conflicts of interest
There are no conflicts of interest.
| References | | |
| 1. | Wang X, Willing MC, Marazita ML, Wendell S, Warren JJ, Broffitt B, et al. Genetic and environmental factors associated with dental caries in children: The Iowa Fluoride Study. Caries Res 2012;46:177-84.  |
| 2. | Petersen PE. The World Oral Health Report 2003: Continuous improvement of oral health in the 21 st century the approach of the WHO Global Oral Health Programme. Community Dent Oral Epidemiol 2003;31:3-24. |
| 3. | GBD 2015 Disease and Injury Incidence and Prevalence Collaborators. Global, regional, and national incidence, prevalence, and years lived with disability for 310 acute and chronic diseases and injuries, 1990-2015: A systematic analysis for the Global Burden of Disease Study 2015. Lancet 2016;388:1545–602. |
| 4. | Balaji SM. Burden of dental diseases in India as compared to South Asia: An insight. Indian J Dent Res 2018;29:374-7. [ PUBMED] [Full text] |
| 5. | Mehta A. Trends in dental caries in Indian children for the past 25 year. Indian J Dent Res 2018;29:323-8. [ PUBMED] [Full text] |
| 6. | Forssten SD, Björklund M, Ouwehand AC. Streptococcus mutans, caries and simulation models. Nutrients 2010;2:290-8. |
| 7. | Nishikawara F, Katsumura S, Ando A. Correlation of cariogenic bacteria and dental caries in adults. J Oral Sci 2006;48:245–51. |
| 8. | Takahashi N, Nyvad B. The role of bacteria in the caries process. J Dent Res 2010;90:294-303. |
| 9. | Owen OW. A study of bacterial counts (lactobacilli) in saliva related to orthodontic appliances. Am J Orthodontists 1949;35:672–8. |
| 10. | Bernardeau M, Guguen M, Vernoux JP. Beneficial lactobacilli in food and feed: Long-term use, biodiversity and proposals for specific and realistic safety assessments. FEMS Microbiol Rev 2006;30:487–513. |
| 11. | Caufield PW, Schön CN, Saraithong P, Li Y, Argimón S. Oral lactobacilli and dental caries: A model for niche adaptation in humans. J Dent Res 2015;94:110S-8S. |
| 12. | Ramamurthy PH, Swamy HS, Bennete F, Rohini M, Nagarathnamma T. Relationship between severe-early childhood caries, salivary mutans streptococci, lactobacilli in preschool children of low socioeconomic status in Bengaluru city. J Indian Society Pedodontics Prev Dent 2014;32:44-7. |
| 13. | Lalloo R, Tadakamadla SK, Kroon J, Tut O, Kularatna S, Boase R, et al. Salivary characteristics and dental caries experience in remote Indigenous children in Australia: A cross-sectional study. BMC Oral Health 2019;19:21. |
| 14. | Salvetti E, Torriani S, Felis GE. The genus Lactobacillus: A taxonomic update. Probiotics Antimicrob Proteins 2012;4:217–26. |
| 15. | Ahirwar SS, Gupta G, Singh V, Gupta MK. Screening, isolation and identification of lactobacillus species from dental caries of children. Int J Curr Microbiol App Sci 2017;6:497-503. |
| 16. | Bhaduri S, Demchick PH. Simple and rapid method for disruption of bacteria for protein studies. Appl Environ Microbiol 1983;46:941-3. |
| 17. | Sánchez I, Seseña S, Palop L. Identification of lactic acid bacteria from spontaneous fermentation of “Almagro” eggplants by SDS-PAGE whole cell protein fingerprinting. Int J Food Microbiol 2003;82:181–9. |
| 18. | Ghazi F, Henni DE, Benmechernene Z, Kihal M. Phenotypic and whole cell protein analysis by SDS-PAGE for identification of dominants lactic acid bacteria isolated from algerian raw milk. World J Dairy Food Sci 2009;4:78–87. |
| 19. | Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. “Protein measurement with the Folin phenol reagent”. J Biological Chem 1951;193:265–75. |
| 20. | Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680-5. |
| 21. | Sambrook J, Russell DW. Purification of nucleic acids by extraction with phenol: Chloroform. Cold Spring Harb Protoc 2006;1. doi: 10.1101/pdb.prot4455. |
| 22. | Srinivasan R, Karaoz U, Volegova M, MacKichan J, Kato-Maeda M, et al. Use of 16S-rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens. PLOS ONE 2015; 10: e0117617. https://doi.org/10.1371/journal.pone.0117617 |
| 23. | Hunter PB. Risk factors in dental caries. Int Dent J 1988;38:211-7. |
| 24. | Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE. Defining the normal bacterial flora of the oral cavity. J Clin Microbiol 2005;43:5721–32. |
| 25. | Aas JA, Griffen AL, Dardis SR, Lee AM, Olsen I, Dewhirst FE, et al. Bacteria of dental caries in primary and permanent teeth in children and young adults. J Clin Microbiol 2008;46:1407–17. |
| 26. | Featherstone JD. Dental caries: A dynamic disease process. Aus Dent J 2008;53:286–91. |
| 27. | Teanpaisan R, Dahlen G. Use of polymerase Chain Reaction techniques and sodium dodecyl sulphate-polyacrylamide gel electrophoresis for differenciation of oral Lactobacillus species. Oral Microbiol Immunol 2006;21:79–83. |
| 28. | Piwat S, Teanpaisan R, Thitasomakul S, Thearmontree A, Dahlén G. Lactobacillus species and genotypes associated with dental caries in Thai preschool children. Mol Oral Microbiol 2010;25:157-64. |
| 29. | Yang R, Argimon S, Li Y, Gu H, Zhou X, Caufield PW. Determining the genetic diversity of lactobacilli from the oral cavity. J Microbiol Methods 2010;82:163–9. |
| 30. | Anderson AC, Sanunu M, Schneider C, Clad A, Karygianni L, Hellwig E, et al. Rapid species-level identification of vaginal and oral lactobacilli using MALDI-TOF MS analysis and 16S rDNA sequencing. BMC Microbiol 2014;14:312. |
| 31. | Zhang Y, Liu Y, Ma Q, Song Y, Zhang Q, Wang X, et al. Identification of Lactobacillus from the saliva of adult patients with caries using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. PLoS One 2014;9:e106185. |
| 32. | Chhour KL, Nadkarni MA, Byun R, Martin FE, Jacques NA, Hunter N. Molecular analysis of microbial diversity in advanced caries. J Clin Microbiol 2005;43:843-9. |
| 33. | Obata J, Takeshita T, Shibata Y, Yamanaka W, Unemori M. Identification of the microbiota in carious dentin lesions using 16S-rRNA gene sequencing. PLoS One 2014;9:e103712. |
| 34. | Kianoush N, Adler CJ, Nguyen AT, Browne GV, Simonian M, Hunter N. Bacterial profile of dentine caries and the impact of pH on bacterial population diversity. PLoS One 2014;9:e92940. |
| 35. | Caufield PW, Li Y, Dasanayake A, Saxena D. Diversity of lactobacilli in the oral cavities of young women with dental caries. Caries Res 2007;41:2-8. |
| 36. | Gross EL, Eugene J, Stephen LR, Noah GD, Judith FA, Daniel SA, et al. Bacterial 16S sequence analysis of severe caries in young permanent teeth. J Clin Microbiol 2010;48:4121-8. |
| 37. | Mahajan B, Sohuche Y, Hayes J, Singh V, Marotta F, Yadav H, Singh V. MALDI-TOF MS spectrophotometric and 16S rRNS gene sequencing identification of probiotic lactic acid bacteria isolated from dairy food products. Int J Probiotics Prebiotics 2017;12:199-210. |
Correspondence Address:
Dr. Sonu Singh Ahirwar
Department of Microbiology, Barkatullah University Bhopal, Madhya Pradesh - 462 026
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/ijdr.IJDR_298_19
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8]
[Table 1], [Table 2], [Table 3], [Table 4] |
Users online:
